View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0100_high_5 (Length: 244)
Name: NF0100_high_5
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0100_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 22 - 210
Target Start/End: Original strand, 39147833 - 39148018
Alignment:
Q |
22 |
caagtatcacaaacttgatcatcatcatcaccattattttcatcgttctcaacaatagttccttctctttcatgattcccttgctcccctttccaaacat |
121 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |||||||| || ||| ||| ||| |||||||||||||||||||||| |||||||||||||||| |
|
|
T |
39147833 |
caagtatcacaaacttgatca---tcatcaccattgttttcatcattatcagtaattgtttcttctctttcatgattcccttgttcccctttccaaacat |
39147929 |
T |
 |
Q |
122 |
tcttcacatgcaaaatcttcaaaacccaattctctctctgcccctccctacaatcctcaccgtcatccccaacggtttttgtttctctg |
210 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39147930 |
tcttgacatgcaaaatcttcaaaacccaattctctctctgcccctccctacaatcctcaccgtcatccccaacggtttttgtttctctg |
39148018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1408 times since January 2019
Visitors: 1420