View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0100_low_10 (Length: 273)
Name: NF0100_low_10
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0100_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 45 - 238
Target Start/End: Complemental strand, 39694556 - 39694363
Alignment:
| Q |
45 |
atcatcatagttgtctgaaatgcgaaaagtatatgtaatagagaagtgattgagaaaatttcaatcttgcattacaattatcacaagaaaagttatgaac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694556 |
atcatcatagttgtctgaaatgcgaaaagtatatgtaatagagaagtgattgagaaaatttcaatcttgcattacaattatcacaagaaaagttatgaac |
39694457 |
T |
|
| Q |
145 |
taagttttacagtccctgagctcattcggaggtcaacttctgatgccactttattgtagaatgtgttctgtgattctttgctgcttctgtgctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694456 |
taagttttacagtccctgagctcattcggaggtcaacttctgatgccactttattgtagaatgtgttctgtgattctttgctgcttctgtgctc |
39694363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1647 times since January 2019
Visitors: 1426