View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0100_low_19 (Length: 209)
Name: NF0100_low_19
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0100_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 24 - 102
Target Start/End: Complemental strand, 5922846 - 5922768
Alignment:
Q |
24 |
ctaataatggactagagttgttgtagtgaagaaattaaaactcaatataaaccttcttatttataaaaactttctacct |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5922846 |
ctaataatggactagagttgttgtagtgaagaaattaaaactcaatataaaccttcttatttataaaaactttctacct |
5922768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University