View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0100_low_21 (Length: 206)
Name: NF0100_low_21
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0100_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 47391177 - 47391302
Alignment:
| Q |
1 |
cagcttagctttttctgttttcccaagctagaagtttcttcaaatattttttctccttctttgcgacttccaagcaagctgtcaccgactctgatgcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47391177 |
cagcttagctttttctgttttcccaagctagaagtttcttcaaatattttttctccttctttgcgacttccaagcaagctgtcaccgactctgatgcact |
47391276 |
T |
|
| Q |
101 |
taatttggaggcctccatctctgctc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47391277 |
taatttggaggcctccatctctgctc |
47391302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 40624952 - 40624828
Alignment:
| Q |
1 |
cagcttagctttttctgttttcccaagctagaagtttcttcaaatattttttctccttctttgcgacttccaagcaagctgtcaccgactctgatgcact |
100 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
40624952 |
cagcttagctttctgt-ttttcccaagctagaagtttcttcaagtattttttctccttttttgcaacttccaagcaagctgtcactgactctgatgcact |
40624854 |
T |
|
| Q |
101 |
taatttggaggcctccatctctgctc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40624853 |
taatttggaggcctccatctctgctc |
40624828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1758 times since January 2019
Visitors: 1427