View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0100_low_7 (Length: 292)
Name: NF0100_low_7
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0100_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 43 - 229
Target Start/End: Complemental strand, 31020394 - 31020208
Alignment:
| Q |
43 |
tcttgtgtaggagcacagagaagagagagcgatgctcgactctcttttgatttaactccataccaggtaatatttgttggcatcaaaattactgaaacag |
142 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31020394 |
tcttgtgtatgtgcacagagaagagagagcgatgctcgactctcttttgatttaactccataccaggtaatatttgttggcatcaaaattactgaaacag |
31020295 |
T |
|
| Q |
143 |
cacttcaacactctttaaggcattcttttcatttttctcttttcatctttgtacatggcgtgctctgaatatatgttacgtgatgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31020294 |
cacttcaacactctttaaggcattcttttcatttttctctttacatctttgtacatggcgtgctctgaatatatgttacgtgatgat |
31020208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1591 times since January 2019
Visitors: 1425