View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0100_low_9 (Length: 287)

Name: NF0100_low_9
Description: NF0100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0100_low_9
NF0100_low_9
[»] chr6 (1 HSPs)
chr6 (154-238)||(1807604-1807696)


Alignment Details
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 154 - 238
Target Start/End: Original strand, 1807604 - 1807696
Alignment:
154 aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttt--------tcaaattttcatcatggatcttgagtct 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||    
1807604 aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttttcaaaacatcaaattttcatcatggatcttgagtct 1807696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University