View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0101_low_1 (Length: 333)
Name: NF0101_low_1
Description: NF0101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0101_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 32535701 - 32535886
Alignment:
| Q |
11 |
aatgagagcacataaatgatcatatatactttcaatccgaatcacatgaatggggatcatatactaaaatggataaaatctatctgtgtgtgannnnnnn |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32535701 |
aatgagagcacataaatgatcatatttactttcaatccgaatcacatgaat-gggatcatatactaaaatagataaaatctatctgtgtgtgattttttt |
32535799 |
T |
|
| Q |
111 |
nnnnnnnnnnnnnnnnnncttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32535800 |
tctcttctagttttttttcttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaac |
32535886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1440 times since January 2019
Visitors: 1420