View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0101_low_3 (Length: 301)
Name: NF0101_low_3
Description: NF0101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0101_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 52 - 291
Target Start/End: Complemental strand, 12868145 - 12867906
Alignment:
| Q |
52 |
attggtgaacattcttcttttctcatgcgtgtgcagtttctttgatctttgtttacttctgtttgtttgacaggatttgttcacctatacaaagtgatat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868145 |
attggtgaacattcttcttttctcatgcgtgtgcagtttctttgatctttgtttacttctgtttgtttgacaggatttgttcacctatacaaagtgatat |
12868046 |
T |
 |
| Q |
152 |
tagggctttactttattttggactattctaattgtggcaacatgatctatagccacatgaatcttccttgaggaaggtatgttacgtagatagaggttta |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12868045 |
tagggttttactttattttggactattctaaatgtggcaacatgatctatagccacatgaatcttccttgaggaaggtatgttacgtagatagaggttta |
12867946 |
T |
 |
| Q |
252 |
attgaggaaggtatgttaagtaaacttggaattggttcat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12867945 |
attgaggaaggtatgttaagtaaacttggaatttgttcat |
12867906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University