View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0101_low_7 (Length: 245)
Name: NF0101_low_7
Description: NF0101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0101_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 165 - 228
Target Start/End: Complemental strand, 12117129 - 12117065
Alignment:
Q |
165 |
aaattaatacattacgttgttgtc-tgtacatcaagtgtctttatttataaataggttacttgat |
228 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12117129 |
aaattaatacattacgttgttgtcatgcacatcaagtgtctttatttataaataggttagttgat |
12117065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 51 - 145
Target Start/End: Complemental strand, 12117209 - 12117114
Alignment:
Q |
51 |
tcctatttctttgactttca----agtttgtgtcagaaagttattttgtcattaacaataaaataatagtagtctataaaattaaattcagacattacg |
145 |
Q |
|
|
|||||||||||||||||||| || | ||||||||||||||||||||||| ||||||||||||| || |||||||||||||||| | |||||||| |
|
|
T |
12117209 |
tcctatttctttgactttcatgctagctagtgtcagaaagttattttgtcatgaacaataaaataa---tactctataaaattaaattaatacattacg |
12117114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University