View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0102_high_1 (Length: 298)
Name: NF0102_high_1
Description: NF0102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0102_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 78 - 243
Target Start/End: Original strand, 35762286 - 35762451
Alignment:
Q |
78 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35762286 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
35762385 |
T |
 |
Q |
178 |
tgcagtgtatagaggccgtttctgtgnnnnnnnaacagcataatttttgttgttgtttggtctctg |
243 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
T |
35762386 |
tgcagtgtatagaggccgtttctgtgtttttttaacagcataatttttgttgttgtttggtttctg |
35762451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University