View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0103_low_6 (Length: 249)
Name: NF0103_low_6
Description: NF0103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0103_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 37 - 249
Target Start/End: Complemental strand, 33460420 - 33460197
Alignment:
| Q |
37 |
caatgaaagttgcaaatggtcccttcttttgcatttcataatt---tcatacacggaatcatatctttcttacttttatatat----tttatctcattat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33460420 |
caatgaaagttgcaaatggtcccttcttttgcatttcataattatttcatacacggaatcatatctttcttacttttatatatatattttatctcattat |
33460321 |
T |
 |
| Q |
130 |
gcatgtggtccgtgcatgtaattaattagttaaataagtatataaaaaataattgtct----nnnnnnnnnnnnnnnggattgtggaaagctaagagtgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33460320 |
gcatgtggtccgtgcatgtaattaattagttaaataagtatataaaaaataattgtcttatatatatatatatatatggattgtggaaagctaagagtgg |
33460221 |
T |
 |
| Q |
226 |
aggggacgaacctgatttctggaa |
249 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33460220 |
aggggacgaacctgatttctggaa |
33460197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University