View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0104_high_14 (Length: 233)

Name: NF0104_high_14
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0104_high_14
NF0104_high_14
[»] chr4 (1 HSPs)
chr4 (24-83)||(23768805-23768861)


Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 23768861 - 23768805
Alignment:
24 catattttcatatttgaacttaaatcatatcatgtgtgccaaaaagattcatccattcat 83  Q
    |||||||||||||||||||||||||||||||||    ||| |||||||||||||||||||    
23768861 catattttcatatttgaacttaaatcatatcat---agcccaaaagattcatccattcat 23768805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10516 times since January 2019
Visitors: 10028