View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_high_17 (Length: 219)
Name: NF0104_high_17
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0104_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 28673371 - 28673249
Alignment:
Q |
1 |
tgatgcaaaatacaaacatcataagagggaatgatttttccacactttcacatttctnnnnnnnctacacctgatttcataagtgaactttcacatgata |
100 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
28673371 |
tgatgcaaaataccaacatcataagagggaatgatttttccacactttcacatttctaaaaaaactacacctgatatcataagtgaactttcacatgata |
28673272 |
T |
 |
Q |
101 |
taatttatctggttatcatttct |
123 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
28673271 |
taatttatctggttatcatttct |
28673249 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University