View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0104_high_17 (Length: 219)

Name: NF0104_high_17
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0104_high_17
NF0104_high_17
[»] chr2 (1 HSPs)
chr2 (1-123)||(28673249-28673371)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 28673371 - 28673249
Alignment:
1 tgatgcaaaatacaaacatcataagagggaatgatttttccacactttcacatttctnnnnnnnctacacctgatttcataagtgaactttcacatgata 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||       ||||||||||| ||||||||||||||||||||||||    
28673371 tgatgcaaaataccaacatcataagagggaatgatttttccacactttcacatttctaaaaaaactacacctgatatcataagtgaactttcacatgata 28673272  T
101 taatttatctggttatcatttct 123  Q
    |||||||||||||||||||||||    
28673271 taatttatctggttatcatttct 28673249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1684 times since January 2019
Visitors: 1426