View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_10 (Length: 314)
Name: NF0104_low_10
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0104_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 83 - 218
Target Start/End: Complemental strand, 16352957 - 16352822
Alignment:
Q |
83 |
agatgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaaggg |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16352957 |
agatgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaaggg |
16352858 |
T |
 |
Q |
183 |
ttgaatctcagtggatcctgcaggaagctacttctt |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
16352857 |
ttgaatctcagtggatcctgcaggaagctacttctt |
16352822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University