View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_16 (Length: 250)
Name: NF0104_low_16
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0104_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 48450431 - 48450651
Alignment:
Q |
1 |
caaaacttactcaggactcaccaaattcacctatagatgacctagtagtctctcaaaacagcttagatgaaggaaaagataaggaacagaatcctcaaat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
48450431 |
caaaacttactcaggactcaccaaattcacctatagatgacctagtagtctctcaaaacagcttagaggaaggaaaagataaggaacagaatcctcaaat |
48450530 |
T |
 |
Q |
101 |
tcgactagcttatgacattgctgcctcagctgcctcctatgttcaactgcgagctaagaaccttttgacccttgctgctaagtcacaacagagtaaaaat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48450531 |
tcgactagcttatgacattgctgcctcagctgcctcctatgttcaattgcgagctaagaaccttttgacccttgctgctaagtcacaacagagtaaaaat |
48450630 |
T |
 |
Q |
201 |
gaagattctagtggaagaaag |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
48450631 |
gaagattctagtggaagaaag |
48450651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1704 times since January 2019
Visitors: 1426