View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_2 (Length: 438)
Name: NF0104_low_2
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0104_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 296 - 409
Target Start/End: Complemental strand, 52734431 - 52734318
Alignment:
Q |
296 |
ttttaatacctggagaagaagcataacaatagcaaagaaaaccttagtgatctcagtcaaaaaattaacactgattgggctgaaattgaatttgccatcg |
395 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52734431 |
ttttattacctggagaagaagcataacaatagcaaagaaaaccttagtgatctcagtcaaaaaattaacactgattgggctgaaattgaatttgccatcg |
52734332 |
T |
 |
Q |
396 |
actttggacatata |
409 |
Q |
|
|
|||||||||||||| |
|
|
T |
52734331 |
actttggacatata |
52734318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 52734580 - 52734457
Alignment:
Q |
127 |
atattccataggaatgattaatatagtacctgcatgaatgtagaaatagagagaagaggtttctccccaaccttttgattcctagcctgcaaaagtaatg |
226 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
T |
52734580 |
atattccatagaaatgattaatatagtacctgcatgaatgtagaaatagagagaagaggtttatcaccaaccttttgattcctagcctgcaaaagtaatg |
52734481 |
T |
 |
Q |
227 |
aaacctaaggatatacgaacaact |
250 |
Q |
|
|
|||| | |||||||| ||| |||| |
|
|
T |
52734480 |
aaacattaggatataagaaaaact |
52734457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University