View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_20 (Length: 233)
Name: NF0104_low_20
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0104_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 23768861 - 23768805
Alignment:
| Q |
24 |
catattttcatatttgaacttaaatcatatcatgtgtgccaaaaagattcatccattcat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23768861 |
catattttcatatttgaacttaaatcatatcat---agcccaaaagattcatccattcat |
23768805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1669 times since January 2019
Visitors: 1426