View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0104_low_21 (Length: 227)

Name: NF0104_low_21
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0104_low_21
NF0104_low_21
[»] chr1 (1 HSPs)
chr1 (23-211)||(39147833-39148018)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 39147833 - 39148018
Alignment:
23 caagtatcacaaacttgatcatcatcatcaccattattttcatcgttctcaacaatagttccttctctttcatgattcccttgctcccctttccaaacat 122  Q
    |||||||||||||||||||||   ||||||||||| |||||||| || |||  ||| ||| |||||||||||||||||||||| ||||||||||||||||    
39147833 caagtatcacaaacttgatca---tcatcaccattgttttcatcattatcagtaattgtttcttctctttcatgattcccttgttcccctttccaaacat 39147929  T
123 tcttcacatgcaaaatcttcaaaacccaattctctctctgcccctccctacaatcctcaccgtcatccccaacggtttttgtttctctg 211  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39147930 tcttgacatgcaaaatcttcaaaacccaattctctctctgcccctccctacaatcctcaccgtcatccccaacggtttttgtttctctg 39148018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1757 times since January 2019
Visitors: 1427