View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_22 (Length: 222)
Name: NF0104_low_22
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0104_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 12509131 - 12509339
Alignment:
Q |
1 |
ccaacttggtaatatgtacactgttggtattttgggagaatctaaatcaatcattatattgaactaagaacaaatacacaagttcgtttggacaccgcgg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |
|
|
T |
12509131 |
ccaacttggtaatatgtacactgttggtattttgggacaatctaaatcaatcattatattgaactaagaacaaatacacaagttagtttgaacaccgcag |
12509230 |
T |
 |
Q |
101 |
cttcactcacaaccttaaaatattatcaatgtggccttctaatgtggtcttttaactcacacttttcacataaatattctctccctcaagtatgagactc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
T |
12509231 |
cttcactcacaaccttaaaatattatcaatgtggccttctaatgtggtcttttaactcacacttttcacataaatattctctccttcaagtatgagattc |
12509330 |
T |
 |
Q |
201 |
tctgcatct |
209 |
Q |
|
|
||||||||| |
|
|
T |
12509331 |
tctgcatct |
12509339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University