View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_23 (Length: 219)
Name: NF0104_low_23
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0104_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 28673371 - 28673249
Alignment:
| Q |
1 |
tgatgcaaaatacaaacatcataagagggaatgatttttccacactttcacatttctnnnnnnnctacacctgatttcataagtgaactttcacatgata |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28673371 |
tgatgcaaaataccaacatcataagagggaatgatttttccacactttcacatttctaaaaaaactacacctgatatcataagtgaactttcacatgata |
28673272 |
T |
|
| Q |
101 |
taatttatctggttatcatttct |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28673271 |
taatttatctggttatcatttct |
28673249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1503 times since January 2019
Visitors: 1423