View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0104_low_9 (Length: 339)
Name: NF0104_low_9
Description: NF0104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0104_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 4487525 - 4487834
Alignment:
| Q |
1 |
aaaaacttagaacttgattgtttgcgtaagaattcttggattacgttgaattataattaatggactgcctttgaagttttcttttaatgtttttgataga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4487525 |
aaaaacttagaacttgattgtttgcgtaagaattcttggattacgttgaattataattaatggactgtctttgaagttttctattaatgtttttgataga |
4487624 |
T |
|
| Q |
101 |
tcaactcgccattaggcaatggtcttagtttttgctcttctaattttgaaatttctatgttatatttttgtgttgtgattgaatccttttattttctcta |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4487625 |
tcaactcgccattaggcaattgtcttagtttttgctcttctaattttgaagtttctatgttatatttttgtgttgtgattgagtctttttattttctcta |
4487724 |
T |
|
| Q |
201 |
tgccgattttctccaacaccaccaacgttgcctaaccccgcgttatacaggttgatggtgaggcacgcgggtagtgtgtgaagatacaaagctaggaagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487725 |
tgccgattttctccaacaccaccaacgttgcctaaccccgcgttatacaggttgatggcgaggcgcgcgggtagtgtgtgaagatacaaagctaggaagg |
4487824 |
T |
|
| Q |
301 |
gagtggatat |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
4487825 |
gagtggatat |
4487834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 1425