View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0105-INSERTION-1 (Length: 517)
Name: NF0105-INSERTION-1
Description: NF0105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0105-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 3e-86; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 156 - 333
Target Start/End: Original strand, 43538044 - 43538221
Alignment:
| Q |
156 |
tatatatatgatttgtaacactttaaactaatcactcaagcaataatatagaactataattgtttccaaatcaatcgtaaacgattgtgttcattgtctt |
255 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538044 |
tatatatatgacttgtaacactgtaaattaatcactcaagtaataatatagaactataattgtttccaaatcaatcgtaaacgattgtgttcattgtctt |
43538143 |
T |
 |
| Q |
256 |
gtgatttatcttttttattattcttatgttgctagttgttgttctaataaaaatgtctttgactcgtttaatcaattg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538144 |
gtgatttatcttttttattattcttatgttgctagttgttgttctaataaaaatgtctttgactcgtttaatcaattg |
43538221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 7 - 101
Target Start/End: Original strand, 43537943 - 43538036
Alignment:
| Q |
7 |
gttttgattggtgagtatggctcataggcacaaaaagatcggtaaggagcgagagagttgagcgagcgtcgtgacatttgctccttttctttcat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
43537943 |
gttttgattggtgagtatggctcataggcacaaaa-gatcggtaaggggcgagagagttgagcgaccgtcgtgacatttgctcctattctttcat |
43538036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 434 - 517
Target Start/End: Original strand, 43537860 - 43537947
Alignment:
| Q |
434 |
aattgtaagactttggacacatcgtatgtgaaatagatttttgttgtcaaataatcacac----tatgaaaccatattagctggtttt |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43537860 |
aattgtaagactttggacacatcgtatgtgaaatagatttttgttgtcaaataatcacactatatatgaaaccatattagctggtttt |
43537947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University