View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0105-INSERTION-10 (Length: 131)
Name: NF0105-INSERTION-10
Description: NF0105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0105-INSERTION-10 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 37145129 - 37144998
Alignment:
Q |
1 |
gcctcaaagaacaagcagaaaaggcgcaagtaaatgttctcagaaagcatattcttccaaccttgatgcttgagattggatgtccaagtcaa-ttttctg |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
T |
37145129 |
gcctcaaagaacaagcagaaaaggcgcaagtaaatgttctcagaaagcatattcttccaaccatgatgcttgagattggatgtccaagtcaatttttctg |
37145030 |
T |
 |
Q |
100 |
tgtatttatatggaatctcatcaatattgatg |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
37145029 |
tgtatttatatggaatctcatcaatattgatg |
37144998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University