View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0105-INSERTION-5 (Length: 339)
Name: NF0105-INSERTION-5
Description: NF0105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0105-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 9 - 196
Target Start/End: Original strand, 12185905 - 12186090
Alignment:
Q |
9 |
tacaatggtgttctgcaaccaataattgggtcatcaacaaaaaactttctgttccatttcannnnnnnggtttccccccaaataaatcaaacatgtgata |
108 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
12185905 |
tacaatggtgttttgcaaccaataattgggtcatcaacaaaaaactttctgttccatttcatttttttggtt--cccccaaataaatcaaacatgtgata |
12186002 |
T |
 |
Q |
109 |
tgttattgcaagttataatttgcagtgttaaaggttgagtcctaggtcgttataagtctagggagctttcatgtctgaagagtgaatt |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
12186003 |
tgttattgcaagttataatttgcagtgttaaaggttgattcctaggtcgttataagtctagggagcttttatgtctgaagagtgaatt |
12186090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 193 - 322
Target Start/End: Original strand, 12185765 - 12185894
Alignment:
Q |
193 |
aattggctccgattgccattgatatttctttatggcgggcagccacaccttccaacaacgcatcaatttccacaatataatgactgcatgttcattgcgc |
292 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12185765 |
aattggccccgattgccattgatatttctttatggcgggcagcaacaccttccaacaacgcatcaatttccacaatataatgactgcatgttcattgcgc |
12185864 |
T |
 |
Q |
293 |
cgatattgggaaaaacaggctgaacccaat |
322 |
Q |
|
|
| |||||| ||||||||||||||||||||| |
|
|
T |
12185865 |
caatattgcgaaaaacaggctgaacccaat |
12185894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 205 - 268
Target Start/End: Original strand, 12191315 - 12191378
Alignment:
Q |
205 |
ttgccattgatatttctttatggcgggcagccacaccttccaacaacgcatcaatttccacaat |
268 |
Q |
|
|
||||||||||| |||||||||||||||||| || ||||||||||| ||||||||||||||||| |
|
|
T |
12191315 |
ttgccattgatctttctttatggcgggcagagacgccttccaacaatgcatcaatttccacaat |
12191378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 7 - 46
Target Start/End: Original strand, 12191438 - 12191477
Alignment:
Q |
7 |
actacaatggtgttctgcaaccaataattgggtcatcaac |
46 |
Q |
|
|
||||||||||||||||||||||||||| ||| |||||||| |
|
|
T |
12191438 |
actacaatggtgttctgcaaccaataactggatcatcaac |
12191477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University