View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0105-INSERTION-8 (Length: 126)
Name: NF0105-INSERTION-8
Description: NF0105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0105-INSERTION-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 24766746 - 24766626
Alignment:
| Q |
1 |
gctgagtggatattaaaaaatgaggatgattgatattctaaaagaatggtcttaatataaaagaatgcaggaagccggtccattatattattttctaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||| ||||||| |||||||| || |||||| |
|
|
| T |
24766746 |
gctgagtggatattaaaaaatgaggatggtagatattctaaaagaatggtcttaatacaaaagaatgcatgaagccgttccattat-----ttcctaaaa |
24766652 |
T |
 |
| Q |
101 |
gaatgcacttaaagtggagtaaatac |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24766651 |
gaatgcacttaaagtggagtaaatac |
24766626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University