View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0105-INSERTION-9 (Length: 93)
Name: NF0105-INSERTION-9
Description: NF0105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0105-INSERTION-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 7e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 7e-46
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 3307794 - 3307886
Alignment:
| Q |
1 |
gagtatggaacctggaggcttaagggtcatgatgagcaatgatgttacttttgatgagacttgtatgaggatgaagtacaaagacttgtatgt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307794 |
gagtatggaacctggaggcttaagggtcatgatgagcaatgatgttacttttgatgagacttgtatgaggatgaagtacaaagacttgtatgt |
3307886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 17934541 - 17934585
Alignment:
| Q |
41 |
gatgttacttttgatgagacttgtatgaggatgaagtacaaagac |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
17934541 |
gatgttacttttgatgagacccgtatggggatgaagtgcaaagac |
17934585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 22623703 - 22623656
Alignment:
| Q |
41 |
gatgttacttttgatgagacttgtatgaggatgaagtacaaagacttg |
88 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||| |||||||||| |
|
|
| T |
22623703 |
gatgttacttttgatgagacccgaatggggatgaagtgcaaagacttg |
22623656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University