View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_10 (Length: 250)
Name: NF0106_low_10
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0106_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 32666999 - 32666782
Alignment:
Q |
11 |
gattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatat |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32666999 |
gattatcctttatcttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatat |
32666900 |
T |
 |
Q |
111 |
tggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatg |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32666899 |
tggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatg |
32666800 |
T |
 |
Q |
211 |
gaggttgatattgatgat |
228 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
32666799 |
gaggttgatattgatgat |
32666782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 37315809 - 37315765
Alignment:
Q |
71 |
tttatagctgcggttttttctatgcaagggtttggtatattggct |
115 |
Q |
|
|
||||||||| |||||||| |||||||||||||||| || |||||| |
|
|
T |
37315809 |
tttatagcttcggtttttgctatgcaagggtttggaattttggct |
37315765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1605 times since January 2019
Visitors: 1426