View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0106_low_10 (Length: 250)

Name: NF0106_low_10
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0106_low_10
NF0106_low_10
[»] chr4 (1 HSPs)
chr4 (11-228)||(32666782-32666999)
[»] chr3 (1 HSPs)
chr3 (71-115)||(37315765-37315809)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 32666999 - 32666782
Alignment:
11 gattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatat 110  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666999 gattatcctttatcttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatat 32666900  T
111 tggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666899 tggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatg 32666800  T
211 gaggttgatattgatgat 228  Q
    ||||||||||||||||||    
32666799 gaggttgatattgatgat 32666782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 37315809 - 37315765
Alignment:
71 tttatagctgcggttttttctatgcaagggtttggtatattggct 115  Q
    ||||||||| |||||||| |||||||||||||||| || ||||||    
37315809 tttatagcttcggtttttgctatgcaagggtttggaattttggct 37315765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University