View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_13 (Length: 231)
Name: NF0106_low_13
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0106_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 174
Target Start/End: Original strand, 45565521 - 45565676
Alignment:
| Q |
19 |
cacagatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatagaactcct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45565521 |
cacagatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatggaactcct |
45565620 |
T |
|
| Q |
119 |
ctctcttgaagtctcataagagtaggaagaatacctccaagcacacttcaaagaaa |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565621 |
ctcttttgaagtctcataagagtaggaagaatacctccaagcacacttcaaagaaa |
45565676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 93
Target Start/End: Complemental strand, 45286972 - 45286940
Alignment:
| Q |
61 |
ccaatcgttctcatagtttgtttcacaatgggg |
93 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45286972 |
ccaatcgttctcgtagtttgtttcacaatgggg |
45286940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1776 times since January 2019
Visitors: 1427