View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_14 (Length: 231)
Name: NF0106_low_14
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0106_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 72 - 181
Target Start/End: Complemental strand, 30417282 - 30417173
Alignment:
| Q |
72 |
gctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaacatatgatattcggtg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30417282 |
gctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaacatatgatattcggtg |
30417183 |
T |
|
| Q |
172 |
gtgggttttc |
181 |
Q |
| |
|
|||||||||| |
|
|
| T |
30417182 |
gtgggttttc |
30417173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1791 times since January 2019
Visitors: 1427