View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_2 (Length: 351)
Name: NF0106_low_2
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0106_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 81 - 255
Target Start/End: Original strand, 7976882 - 7977062
Alignment:
| Q |
81 |
atatctacaaatcaa---gggaaaccgtcatgcctggattagtacagtaaatc---gagtcgtacatcgtgacgaaatccctaaatcatttaccccaact |
174 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7976882 |
atatctacaaatcaacaagggaaaccgtcatgcctggattagtacagtaaatcatcgagtcctacatcgtgacaaaatccctaaatcatttaccccaact |
7976981 |
T |
|
| Q |
175 |
ttgtatttacaaaatgtatttatttacatttgcataagatacataatcgagttgaaactattaggtgtaaatacaaataga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
7976982 |
ttgtatttacaaaatgtatttatttacatttgcataagatacataattgagttgaaacaattaggtgtaaatgcaaataga |
7977062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1655 times since January 2019
Visitors: 1426