View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_4 (Length: 308)
Name: NF0106_low_4
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0106_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 31 - 297
Target Start/End: Complemental strand, 38688518 - 38688254
Alignment:
Q |
31 |
taactatgaccaatggcgatatggaggacatgtgcgggaggagccaccgcacagggcctaaaattttagaannnnnnnnatttttctatttcttcttata |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
38688518 |
taactatgaccaatggcgatatggaggacatgtgcgggaggagccaccgcacagggcgtaaaattttaga---ccccccatttttctatttcttcttata |
38688422 |
T |
 |
Q |
131 |
gatgttcttgatgataaaattctatttgaggaattgaatgtaagccaagagttttaacaattgaataagttttatgatattgagttctcttaatacattt |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38688421 |
gatgttcttgatgataaaattctatttgaggaattgaatgtaagccaggagttttaacaattgaataagttttatgatattgagttctcttaatacattt |
38688322 |
T |
 |
Q |
231 |
tagtatttgctataatgcatgcatatcttatagaat-aatatcaactatctttgttacgcaacagcta |
297 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
T |
38688321 |
tattatttgctataatgcatgcatatcttatagaataaatatcaactatctttgttacgcatcagcta |
38688254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University