View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_5 (Length: 291)
Name: NF0106_low_5
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0106_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 49087551 - 49087755
Alignment:
Q |
1 |
gtcggtgctgccatctatggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087551 |
gtcggtgctgccatctatggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtct |
49087650 |
T |
 |
Q |
101 |
ctgcttactatgacaggttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccgccgctgttcctggagaagcacagtca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087651 |
ctgcttactatgacaggttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccgccgctgttcctggagaagcacagtca |
49087750 |
T |
 |
Q |
201 |
ggtgt |
205 |
Q |
|
|
||||| |
|
|
T |
49087751 |
ggtgt |
49087755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University