View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_6 (Length: 278)
Name: NF0106_low_6
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0106_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 29 - 221
Target Start/End: Original strand, 42738476 - 42738670
Alignment:
| Q |
29 |
tctatcaagttgactgtctcttagcaattacatttgattgaaatatagaagtaaaatgtcaatatagcaacannnnnnnn--atgaatagagtatgattt |
126 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42738476 |
tctatgaagttgactgtctcttagcaattacatttgattgaaatatagaagtaaaatgtcaatatagcaacattttttttttatgaatagagtatgattt |
42738575 |
T |
|
| Q |
127 |
gtattcatctatctatgttggtggatttaatatatcttgtatttatatcttatgaataaaagaattgtttgctgttaaaagaaaatgtgatgatg |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
42738576 |
gtatccatctatctatgttggtggatttaatatctcttgtatttatatcttatgaataaaagaactgtttgctgttaaaagaaaatgtgaagatg |
42738670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1726 times since January 2019
Visitors: 1426