View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0106_low_7 (Length: 269)
Name: NF0106_low_7
Description: NF0106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0106_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 49 - 240
Target Start/End: Complemental strand, 5171930 - 5171744
Alignment:
| Q |
49 |
aacctgtgcttttatgttgggccctttgttacctctagcggaggcagttatgtactcagttggaaagataattgctctttaggcacttgctatttcaacc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5171930 |
aacctgtgcttttatgttgggccctttgttacctctagcggaggcagttatgtgctcagttggaa-gataattgctctttaggcacttgctatttcaacg |
5171832 |
T |
 |
| Q |
149 |
gcagttaactatcattcgttcgtttattcacagtagttaattgatgttcattcaatatcagcggcagttaactaccgttgtgttttgttcat |
240 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5171831 |
gcagttaactatcattcgtt----tatttacagtatttaattgatgttcattcaatatcagcggcagttaactaccgctgtgttttgttcat |
5171744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University