View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0107_high_3 (Length: 310)
Name: NF0107_high_3
Description: NF0107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0107_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 235
Target Start/End: Original strand, 1306482 - 1306686
Alignment:
Q |
30 |
taaacttagttttattttttaaagtatacattaacattaaatctaatttattttgaatcattagatgaagattatagggacactgatgtctcgaccgcgt |
129 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
1306482 |
taaacttaatttt-ttttttaaagtatacattaacattaaatctaatttattttgaatcattagatgaagattatagggacactgatgtctcgacagcgt |
1306580 |
T |
 |
Q |
130 |
gattgcgaaaaatctataatagtagcatgaaatttcatctcatttctagaagaagagattaagagaagcgggaaaacaaactcacaaaacaattcccgct |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1306581 |
gattgcgaaaaatctataatagtagcatgaaatttcatctcatttctagaagaagagattcagagaagcgggaaaacaaactcacaaaacaattcccgct |
1306680 |
T |
 |
Q |
230 |
cccctc |
235 |
Q |
|
|
|||||| |
|
|
T |
1306681 |
cccctc |
1306686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University