View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0107_high_4 (Length: 258)

Name: NF0107_high_4
Description: NF0107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0107_high_4
NF0107_high_4
[»] chr4 (3 HSPs)
chr4 (37-120)||(1428191-1428275)
chr4 (185-241)||(1428069-1428125)
chr4 (41-77)||(1424991-1425027)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 37 - 120
Target Start/End: Complemental strand, 1428275 - 1428191
Alignment:
37 cctccctcggta-tgtaaccctaatttctctttcactctttacactgttctcgattttccttgaaccctagattcaccatttgta 120  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||    
1428275 cctccctcggtaatgtaaccctaatttctctttcactctttacactgttttcgtttttccttgaaccctagattcaccatttgta 1428191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 1428125 - 1428069
Alignment:
185 gggtaatgaataacagagatgggtgaagaagtgaaatctattgttcttgagtctgtg 241  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
1428125 gggtaatgaatcacagagatgggtgaagaagtgaaatctattgttcctgagtctgtg 1428069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 1425027 - 1424991
Alignment:
41 cctcggtatgtaaccctaatttctctttcactcttta 77  Q
    |||||||||||||||||||||||||||||||||||||    
1425027 cctcggtatgtaaccctaatttctctttcactcttta 1424991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University