View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0107_high_4 (Length: 258)
Name: NF0107_high_4
Description: NF0107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0107_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 37 - 120
Target Start/End: Complemental strand, 1428275 - 1428191
Alignment:
Q |
37 |
cctccctcggta-tgtaaccctaatttctctttcactctttacactgttctcgattttccttgaaccctagattcaccatttgta |
120 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
1428275 |
cctccctcggtaatgtaaccctaatttctctttcactctttacactgttttcgtttttccttgaaccctagattcaccatttgta |
1428191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 1428125 - 1428069
Alignment:
Q |
185 |
gggtaatgaataacagagatgggtgaagaagtgaaatctattgttcttgagtctgtg |
241 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
1428125 |
gggtaatgaatcacagagatgggtgaagaagtgaaatctattgttcctgagtctgtg |
1428069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 77
Target Start/End: Complemental strand, 1425027 - 1424991
Alignment:
Q |
41 |
cctcggtatgtaaccctaatttctctttcactcttta |
77 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
1425027 |
cctcggtatgtaaccctaatttctctttcactcttta |
1424991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University