View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0107_low_8 (Length: 223)
Name: NF0107_low_8
Description: NF0107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0107_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 48062768 - 48062643
Alignment:
Q |
1 |
aactatactatcccagatgccatgctgaaatttgctaaggaaaatggcatatctgtcagaggtcataacattttgtgggacagtgaaagacgtcaacctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48062768 |
aactatactatcccagatgccatgctgaaatttgctaaggaaaatggcatatctgtcagaggtcataacattttgtgggacagtgaaagacgtcaacctg |
48062669 |
T |
 |
Q |
101 |
aatgggatttgtccctgtctcctgat |
126 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
48062668 |
aatgggatttgtccctgtctcctgat |
48062643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 48066857 - 48066768
Alignment:
Q |
1 |
aactatactatcccagatgccatgctgaaatttgctaaggaaaatggcatatctgtcagaggtcataacattttgtgggacagtgaaaga |
90 |
Q |
|
|
||||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
48066857 |
aactatactattcctgatgccatgctgaaatttgccaaagaaaatggcatttctgtcagaggtcatgccattttgtgggacgatgaaaga |
48066768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 48099802 - 48099722
Alignment:
Q |
1 |
aactatactatcccagatgccatgctgaaatttgctaaggaaaatggcatatctgtcagaggtcataacattttgtgggac |
81 |
Q |
|
|
|||||||||||||||||||||||| ||||||| || || ||||||||||| |||||||||||||||| | |||| |||||| |
|
|
T |
48099802 |
aactatactatcccagatgccatgatgaaattcgccaaagaaaatggcatttctgtcagaggtcataccgttttctgggac |
48099722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 48106403 - 48106298
Alignment:
Q |
1 |
aactatactatcccagatgccatgctgaaatttgctaaggaaaatggcatatctgtcagaggtcataacattttgtgggacagtgaaagacgtcaacctg |
100 |
Q |
|
|
||||| |||||| ||||||| ||| | |||||||||| || ||||| || ||||||||||||||||||||||| |||||| ||||| | |||||||| |
|
|
T |
48106403 |
aactacactatctcagatgcaatgttagaatttgctaaagataatggaatttctgtcagaggtcataacattttctgggacgatgaaaaatatcaacctg |
48106304 |
T |
 |
Q |
101 |
aatggg |
106 |
Q |
|
|
|||||| |
|
|
T |
48106303 |
aatggg |
48106298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University