View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0108_high_1 (Length: 313)
Name: NF0108_high_1
Description: NF0108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0108_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 191 - 298
Target Start/End: Original strand, 28081796 - 28081903
Alignment:
| Q |
191 |
attggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaagaaatgtagtagctaaagtgaactatttttgtttta |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081796 |
attggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtctgctggagaaagaaatgtagtagctaaagtgaactatttttgtttta |
28081895 |
T |
|
| Q |
291 |
tcattatt |
298 |
Q |
| |
|
|||||||| |
|
|
| T |
28081896 |
tcattatt |
28081903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 28081648 - 28081694
Alignment:
| Q |
44 |
ctttcttccaaaattggtgatgcacaaggagattaaattttctggaa |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081648 |
ctttcttccaaaattggtgatgcacaaggagattaaattttctggaa |
28081694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1447 times since January 2019
Visitors: 1420