View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0108_high_3 (Length: 235)
Name: NF0108_high_3
Description: NF0108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0108_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 411363 - 411581
Alignment:
Q |
1 |
cttgtaaatgctgattacagtgcgaagcaaaaaggccttagcataagcgaggaaagagtagtggtcgattcgtctcctgagctacctgttgagtcaatcc |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
411363 |
cttgtaaatgctgattacattgcgaagcaaaaaggccttcgcataagcgaggaaagagtagtggtcgattcgtctcctgaactacctgttgagtcaatcc |
411462 |
T |
 |
Q |
101 |
agatacagatatccaatgtggagtccaaattcgcgagtgctgtatcagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacacct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
411463 |
agatacagatatccaatgtggagtccaaattcgcgagtgctgtatcagagactggtcagataagcattgatggaaaagtgaagtacggtacaccacacct |
411562 |
T |
 |
Q |
201 |
tacatgtgtgggatctttt |
219 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
411563 |
tacatgtgtgggatctttt |
411581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1407 times since January 2019
Visitors: 1420