View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0108_low_2 (Length: 286)
Name: NF0108_low_2
Description: NF0108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0108_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 47 - 241
Target Start/End: Original strand, 38359987 - 38360181
Alignment:
| Q |
47 |
aaaatcacctgaaacttttcatgttttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattc |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
38359987 |
aaaatcacctgaaacttttcaagttttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattc |
38360086 |
T |
 |
| Q |
147 |
acttcttcaacaccaactggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatcacaggt |
241 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38360087 |
actgcttcaacaccatctggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcaggt |
38360181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University