View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0109-INSERTION-1 (Length: 228)
Name: NF0109-INSERTION-1
Description: NF0109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0109-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 19755481 - 19755694
Alignment:
| Q |
9 |
aaacacataaaaaagtcgaagttaataaagaaggtttgttaaagaaaattaagggaattctcaaagttaagtagagataccttcgacgcattatctccaa |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755481 |
aaacacattaaaaagtcgaagttaataaagaaggtttgttaaagaaaattaagggaattctcaaagttaagtagagataccttcgacgcattatctccaa |
19755580 |
T |
 |
| Q |
109 |
cgcatgaatgtgcactagcaggtttgccttctttacgccctcgatttttctttatggggcccttcacagctgcttctccatcaattacattgttaccatt |
208 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||| | |||| ||||||| |||||||||||||||| |
|
|
| T |
19755581 |
cgcatgaatgtgtactactaggtttgccttgtttacgccctcgatttttctttatggggcccttcacaacagcttttccatcagttacattgttaccatt |
19755680 |
T |
 |
| Q |
209 |
atctggatattctt |
222 |
Q |
| |
|
|||| ||| ||||| |
|
|
| T |
19755681 |
atctagattttctt |
19755694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University