View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0109-INSERTION-9 (Length: 110)
Name: NF0109-INSERTION-9
Description: NF0109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0109-INSERTION-9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 4649454 - 4649353
Alignment:
| Q |
8 |
cctctactcttttatttgtgttctttaatttgattatgaatttgatatatacgtaagttgctagatttattcttggttgaattgttgcttaaccctattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4649454 |
cctctactcttttatttgtgttctttaatttgattatgaatttgatatatacataagttgctagatttattcttggttgaattgttgcttaa-cctattt |
4649356 |
T |
|
| Q |
108 |
agt |
110 |
Q |
| |
|
||| |
|
|
| T |
4649355 |
agt |
4649353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 48098958 - 48098881
Alignment:
| Q |
8 |
cctctactcttttatttgtgttctttaatttgattatgaatttgatatatacgtaagttgctagatttattcttggtt |
85 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||| |||||||| |||| || || ||| || ||||| ||||||||| |
|
|
| T |
48098958 |
cctctactctcttatctatgttctttaatttgattgtgaatttgctatacacatatgttcctcgatttgttcttggtt |
48098881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1296 times since January 2019
Visitors: 1417