View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-11 (Length: 387)
Name: NF0112-INSERTION-11
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0112-INSERTION-11 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 8 - 387
Target Start/End: Original strand, 43418219 - 43418598
Alignment:
| Q |
8 |
gaggctgctttctcactaacaagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatcatcttcagaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43418219 |
gaggctgctttctcactaacaagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatcatcttcagaaag |
43418318 |
T |
|
| Q |
108 |
tatccactgattttattgaaagcagctatctatcattgccaactaaacccaacttttgttgtgtccatcaaaattttatccaaatgcactgatccttgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43418319 |
tatccactgattttattgaaagcagctatctatcattgcccactaaacccaacttttgttgtgtccatcaaaattttatccaaatgcattgatccttgtt |
43418418 |
T |
|
| Q |
208 |
tgcaaacctggaaaacgaaatgaccaaataataataattggggcaccagcatagacatgatgattgatgatacaaacaacactccaaaccaacaaaagta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43418419 |
tgcaaacctggaaaacgaaatgaccaaataataataattggggcaccagcatagacatgatgattgatgatacaaacaacactccaaaccaacaaaagta |
43418518 |
T |
|
| Q |
308 |
acattcagtgaaccttttgattgaggatatatccgattactgttacatcctttttgtgtctctgtctgtgttttgcatcc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43418519 |
acattcagtgaaccttttgattgaggatatatccgattactgttacatcctttttgcgtctctgtctgtgttttgcatcc |
43418598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 43406345 - 43406519
Alignment:
| Q |
16 |
tttctcactaacaagtgacatttatgtgttattcttcttttctggcactggcagcatcaattcttctactcataatcatcatcttcagaaagtatccact |
115 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||| | || ||||||| |
|
|
| T |
43406345 |
tttctcattcacaagtgacatttatgtgttattcttcttttcgggcattggcagcatcaattcttctactc---atcatcatcttcacatagaatccact |
43406441 |
T |
|
| Q |
116 |
gattttattgaaagcagctatctatcattgccaactaaacccaacttttgttgtgtccatcaaaattttatccaaatg |
193 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||| ||||||||||||| || || |||||||||||| ||||| |
|
|
| T |
43406442 |
gattttattgaaagcagctagctatgattgcccactaatcccaacttttgttatggccgccaaaattttatctaaatg |
43406519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1442 times since January 2019
Visitors: 1420