View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-16 (Length: 320)
Name: NF0112-INSERTION-16
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0112-INSERTION-16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 5334297 - 5334504
Alignment:
| Q |
10 |
cggttcaattcaattcctaaaacctgaattgtgtgctgctgctgttgcgctgcgatggcatcatcatcatcattgtcagcgcctaatgtggttttgttcg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334297 |
cggttcaattcaattcctaaaacctgaattgtgtgctgctgctgttgcgctgcaatggcatcatcatcatcattgtcagcgcctaatgtggttttgttcg |
5334396 |
T |
|
| Q |
110 |
atgcttttttccgtcgtgccgatttggattgcgacggtcgtgtcagcggcgtcgaagccgtctccttcttccaaggttccggtttgccccaaaaaatcct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334397 |
atgcttttttccgtcgtgccgatttggattgcgacggtcgtatcagcggcgtcgaagccgtctccttcttccaaggttccggtttgccccaaaaaatcct |
5334496 |
T |
|
| Q |
210 |
tgctcagg |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
5334497 |
tgctcagg |
5334504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 320
Target Start/End: Original strand, 5334562 - 5334597
Alignment:
| Q |
285 |
cactagtgttgtaatgtaatattaacagtagtagta |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334562 |
cactagtgttgtaatgtaatattaacagtagtagta |
5334597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 71 - 217
Target Start/End: Original strand, 43470236 - 43470382
Alignment:
| Q |
71 |
catcatcatcattgtcagcgcctaatgtggttttgttcgatgcttttttccgtcgtgccgatttggattgcgacggtcgtgtcagcggcgtcgaagccgt |
170 |
Q |
| |
|
||||||| || | ||||||||||||||||| | |||||||||||| |||||||||||||||||||||| | ||||| ||| ||||||| ||||||||||| |
|
|
| T |
43470236 |
catcatcttcgtcgtcagcgcctaatgtggatctgttcgatgcttatttccgtcgtgccgatttggatcgtgacggccgtatcagcggtgtcgaagccgt |
43470335 |
T |
|
| Q |
171 |
ctccttcttccaaggttccggtttgccccaaaaaatccttgctcagg |
217 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
43470336 |
ctctttcttccaaggttccggtttgcccaaaaaagtccttgctcagg |
43470382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1439 times since January 2019
Visitors: 1420