View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-17 (Length: 359)
Name: NF0112-INSERTION-17
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0112-INSERTION-17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 99 - 358
Target Start/End: Complemental strand, 23741696 - 23741437
Alignment:
| Q |
99 |
gaacatgttgaatatccaattggagttgacctttataattgtgcatattatacttagtcgaaactactctttgtgataaagttttcaaattattttgaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23741696 |
gaacatgttgaatatccaattggagttgacctttataattgtgcatattatacttcgtcgaaactactctttgtgataaagttttcaaattattttgaat |
23741597 |
T |
 |
| Q |
199 |
agcatttgaagatccacaagagaaccaagtgaaatggtggtcgaaaagccaacgtaaattcagctgttggctgaggtggaaatttaacatagtgaaattc |
298 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| |||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
23741596 |
agcatttgaaaatccacaagagaaccaagggaaatggtggttgaaaagccaatgtaaattcagcagttggcagaggtggaaatttaacatagtgaaattc |
23741497 |
T |
 |
| Q |
299 |
taaagcaaaacattatttttcttttacataaggaagaaaagttagttttggaattttatc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23741496 |
taaagcaaaacattatttttcttttacataaggaagaaaagttagttttggaattttatc |
23741437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 9 - 106
Target Start/End: Original strand, 23664739 - 23664836
Alignment:
| Q |
9 |
aacaatagccttcttagcaggttgtgttggtagaagaggatcaactgcaagggttcgacagatcactcgatgggatgttggtctggattggaacatgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
23664739 |
aacaatagccttcttagcaggttgtgttggtagaagaggatcaactgcaagggttcgacagatcactcgatgggatgttgctctgaattggaacatgt |
23664836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 9 - 106
Target Start/End: Complemental strand, 23793848 - 23793751
Alignment:
| Q |
9 |
aacaatagccttcttagcaggttgtgttggtagaagaggatcaactgcaagggttcgacagatcactcgatgggatgttggtctggattggaacatgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
23793848 |
aacaatagccttcttagcaggttgtgttggtagaagaggatcaactgcaagggttcgacagatcactcgatgggatgttgctctgaattggaacatgt |
23793751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University