View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-18 (Length: 275)
Name: NF0112-INSERTION-18
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0112-INSERTION-18 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 196 - 275
Target Start/End: Complemental strand, 16717657 - 16717578
Alignment:
Q |
196 |
tatttgaagctatgtggttcaatacagcaccaatgaaccctgaaatagagcttaattgatagaattccgtacttaattat |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||| |
|
|
T |
16717657 |
tatttgaagctatgtggttcaatacagcaccaatgaagactgaaatagagcttagttgatagaattttgtacttaattat |
16717578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University