View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-3 (Length: 130)
Name: NF0112-INSERTION-3
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0112-INSERTION-3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 14771464 - 14771593
Alignment:
| Q |
1 |
gagaaataatctaccaattactaattgttttcaattagagtgtctnnnnnnn--tttcatttcatttatgccttttcttatgatgactattagctgctta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14771464 |
gagaaataatctaccaattactaattgttttcatttagagtgtctaagaaaaattttcatttcatttatgccttttcttatgatgactattagctgctta |
14771563 |
T |
|
| Q |
99 |
gatgtttatgtgtgactatgcgtctttaaa |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
14771564 |
gatgtttatgtgtgactatgtatctttaaa |
14771593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1288 times since January 2019
Visitors: 1417