View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0112-INSERTION-4 (Length: 82)

Name: NF0112-INSERTION-4
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0112-INSERTION-4
NF0112-INSERTION-4
[»] chr1 (1 HSPs)
chr1 (1-76)||(3149370-3149445)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 3149370 - 3149445
Alignment:
Q  1 tcttcttgtttgantgatcttaaggagaaattgcactaacctaggagaaattgtctaaatgactcggacttctatt 76  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||    
T  3149370 tcttcttgtttgattgatcttaaggagaaattgcactaacctaggagaaattgtctaaaagaatcgaacttctatt 3149445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5762 times since January 2019
Visitors: 9069