View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0112-INSERTION-9 (Length: 137)
Name: NF0112-INSERTION-9
Description: NF0112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0112-INSERTION-9 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 7e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 50726167 - 50726295
Alignment:
Q |
8 |
gtaagatattcaaacagcataagtaagttatgttttataacannnnnnngatttgtttctaccattattaaatcaaagtcacttcattggatgacatatg |
107 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
T |
50726167 |
gtaagatattcaaat-gcataagtaagttatgttttgtaacatttttttgatttgtttctaccattgtcaaatcaaagtcacttcattggatgacatatg |
50726265 |
T |
 |
Q |
108 |
atggaattattgatcaggtggtgtgttaaa |
137 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
50726266 |
atggaattattgatcaggtggtgtgttaaa |
50726295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 50786681 - 50786553
Alignment:
Q |
8 |
gtaagatattcaaacagcataagtaagttatgttttataacannnnnnngatttgtttctaccattattaaatcaaagtcacttcattggatgacatatg |
107 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
T |
50786681 |
gtaagatattcaaat-gcataagtaagttatgttttgtaacatttttttgatttgtttctaccattgtcaaatcaaagtcacttcattggatgacatatg |
50786583 |
T |
 |
Q |
108 |
atggaattattgatcaggtggtgtgttaaa |
137 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
50786582 |
atggaattattgatcaggtggtgtgttaaa |
50786553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University