View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113-INSERTION-3 (Length: 106)
Name: NF0113-INSERTION-3
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113-INSERTION-3 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 15934444 - 15934398
Alignment:
Q |
60 |
ttctctaaattggttccattatcatctcccaaaaaatcacaaaccat |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15934444 |
ttctctaaattggttccattatcatctcccaaaaaatcacaaaccat |
15934398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 15935434 - 15935389
Alignment:
Q |
13 |
ttcaaattccactcaaccctaacagtttattacccttccttgtttt |
58 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
15935434 |
ttcaaattccactcaaccctaacaatttattacccttccttgtttt |
15935389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 18421666 - 18421702
Alignment:
Q |
57 |
ttattctctaaattggttccattatcatctcccaaaa |
93 |
Q |
|
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
T |
18421666 |
ttattttctaaattgattccattatcatctcccaaaa |
18421702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University