View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0113-INSERTION-3 (Length: 106)

Name: NF0113-INSERTION-3
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0113-INSERTION-3
NF0113-INSERTION-3
[»] chr5 (2 HSPs)
chr5 (60-106)||(15934398-15934444)
chr5 (13-58)||(15935389-15935434)
[»] chr4 (1 HSPs)
chr4 (57-93)||(18421666-18421702)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 15934444 - 15934398
Alignment:
60 ttctctaaattggttccattatcatctcccaaaaaatcacaaaccat 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
15934444 ttctctaaattggttccattatcatctcccaaaaaatcacaaaccat 15934398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 15935434 - 15935389
Alignment:
13 ttcaaattccactcaaccctaacagtttattacccttccttgtttt 58  Q
    |||||||||||||||||||||||| |||||||||||||||||||||    
15935434 ttcaaattccactcaaccctaacaatttattacccttccttgtttt 15935389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 18421666 - 18421702
Alignment:
57 ttattctctaaattggttccattatcatctcccaaaa 93  Q
    ||||| ||||||||| |||||||||||||||||||||    
18421666 ttattttctaaattgattccattatcatctcccaaaa 18421702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University